-
PurposeBacterial expression of codon-optimized His-SUMO-LbuCas13a.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28a(+)
- Total vector size (bp) 9070
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebdSUMO-LbuCas13a (codon-optimized)
-
Alt namec2c2
-
Alt nameLeptotrichia buccalis cas13a
-
SpeciesSynthetic
- Promoter T7 promoter and lac operator
-
Tags
/ Fusion Proteins
- His6 (N terminal on backbone)
- bdSUMO (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenScript
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.medrxiv.org/content/10.1101/2021.03.19.21253328v1 for medRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGJK_His-SUMO-LbuCas13a was a gift from Jennifer Doudna (Addgene plasmid # 172488 ; http://n2t.net/addgene:172488 ; RRID:Addgene_172488) -
For your References section:
Accelerated RNA detection using tandem CRISPR nucleases. Liu TY, Knott GJ, Smock DCJ, Desmarais JJ, Son S, Bhuiya A, Jakhanwal S, Prywes N, Agrawal S, Diaz de Leon Derby M, Switz NA, Armstrong M, Harris AR, Charles EJ, Thornton BW, Fozouni P, Shu J, Stephens SI, Kumar GR, Zhao C, Mok A, Iavarone AT, Escajeda AM, McIntosh R, Kim S, Dugan EJ, Pollard KS, Tan MX, Ott M, Fletcher DA, Lareau LF, Hsu PD, Savage DF, Doudna JA. Nat Chem Biol. 2021 Sep;17(9):982-988. doi: 10.1038/s41589-021-00842-2. Epub 2021 Aug 5. 10.1038/s41589-021-00842-2 PubMed 34354262