-
Purposeexpresses ultraID in mammalian cells with the tet-on or tet-off system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSF3
- Backbone size w/o insert (bp) 8488
- Total vector size (bp) 9042
-
Vector typeMammalian Expression, Retroviral, Luciferase ; to be used in a tet-on or tet-off compatible cell line
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameultraID
-
Speciesaquifex aeolicus
-
Insert Size (bp)554
-
Mutationfragment ([aa2-171]) of aquifex aeolicus BirA with the substitutions R40G and L41P
- Promoter TRE-cmv
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer aaaggccggccccatggaacaaaaactcatctc
- 3′ sequencing primer tatactttctagagaataggaac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe template for the original PCR is addgene number: 74223
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF3-ultraID was a gift from Julien Béthune (Addgene plasmid # 172878 ; http://n2t.net/addgene:172878 ; RRID:Addgene_172878) -
For your References section:
Engineering of ultraID, a compact and hyperactive enzyme for proximity-dependent biotinylation in living cells. Kubitz L, Bitsch S, Zhao X, Schmitt K, Deweid L, Roehrig A, Barazzone EC, Valerius O, Kolmar H, Bethune J. Commun Biol. 2022 Jul 4;5(1):657. doi: 10.1038/s42003-022-03604-5. 10.1038/s42003-022-03604-5 PubMed 35788163