Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET22b-PelB-6H-Ag43-160N-sfGFP
(Plasmid #172886)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172886 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET22b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5359
  • Total vector size (bp) 8727
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SfGFP
  • Alt name
    SfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    714
  • Promoter T7 Promoter
  • Tags / Fusion Proteins
    • HHHHHH (N terminal on insert)
    • TEV recognition site (ENLYFQG) (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Ag43, partial
  • Alt name
    flu gene
  • Insert Size (bp)
    1107
  • Mutation
    Deleted 1-160 (N terminal)
  • Entrez Gene
    flu (a.k.a. b2000, ECK1993, agn, agn43, yeeQ, yzzX)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAAAACCTGTACTTTCAGGGC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    sfGFP amplified from pJT119b vector (addgene #50551)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b-PelB-6H-Ag43-160N-sfGFP was a gift from Urartu Seker (Addgene plasmid # 172886 ; http://n2t.net/addgene:172886 ; RRID:Addgene_172886)
  • For your References section:

    A Self-Actuated Cellular Protein Delivery Machine. Ahan RE, Kirpat BM, Saltepe B, Seker UOS. ACS Synth Biol. 2019 Apr 19;8(4):686-696. doi: 10.1021/acssynbio.9b00062. Epub 2019 Mar 12. 10.1021/acssynbio.9b00062 PubMed 30811932