pX330_ATP1A1_G3_Dual_sgRNA
(Plasmid #173205)

• Purpose: Coselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.
• Depositing Lab: Yannick Doyon
• Publication: Levesque et al Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Total vector size (bp): 8804
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
• gRNA/shRNA sequence: GAGTTCTGTAATTCAGCATA
• Species: H. sapiens (human)
• Promoter: Dual U6 promoters

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SbfI (not destroyed)
• 5′ sequencing primer: GGATTGGGAAGACAATAGCAGGC
• 3′ sequencing primer: GTCCCTATTGGCGTTACTATTGAC

Resource Information

• Supplemental Documents:
  • pX330_ATP1A1_G3_Dual_sgRNA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ATP1A1 G3 sgRNA target ATP1A1 intron 4 and this plasmid can be used to perform coselection for HDR in human cells. This plasmid is derived from pX330-U6-Chimeric_BB-CBh-hSpCas9 and user-specified sgRNA can be cloned using the BbsI sites. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.