Lenti-sgSmarca4#1/Cre
(Plasmid
#173619)
-
PurposeExpresses a Smarca4-targeting gRNA and Cre-recombinase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.3
-
Vector typeLentiviral, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting Smarca4
-
gRNA/shRNA sequenceGGGATGCAGGTCTTACCATG
-
SpeciesM. musculus (mouse)
-
Entrez GeneSmarca4 (a.k.a. BAF190A, Brg1, HP1-BP72, SNF2beta, SW1/SNF, b2b508.1Clo, b2b692Clo)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-sgSmarca4#1/Cre was a gift from Charles Swanton (Addgene plasmid # 173619 ; http://n2t.net/addgene:173619 ; RRID:Addgene_173619) -
For your References section:
A functional taxonomy of tumor suppression in oncogenic KRAS-driven lung cancer. Cai H, Chew SK, Li C, Tsai MK, Andrejka L, Murray CW, Hughes NW, Shuldiner EG, Ashkin EL, Tang R, Hung KL, Chen LC, Lee SYC, Yousefi M, Lin WY, Kunder CA, Cong L, McFarland CD, Petrov DA, Swanton C, Winslow MM. Cancer Discov. 2021 Feb 19. pii: 2159-8290.CD-20-1325. doi: 10.1158/2159-8290.CD-20-1325. 10.1158/2159-8290.CD-20-1325 PubMed 33608386