-
PurposePromotes expression of disulfide-rich protein in E. coli T7 expression system. The plasmid encodes expression of the folding factors Erv1p and hPDI controlled by the Ptac promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173713 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDisCoTune
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions0.5 % Glucose
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameERV1
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneERV1 (a.k.a. YGR029W)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer gccagcccaaatgcaatc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePDI
-
Alt nameprotein disulfide-isomerase
-
SpeciesH. sapiens (human)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ACTTCCAGTATGTTACCGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisCoTune was a gift from Morten Norholm (Addgene plasmid # 173713 ; http://n2t.net/addgene:173713 ; RRID:Addgene_173713) -
For your References section:
DisCoTune: versatile auxiliary plasmids for the production of disulphide-containing proteins and peptides in the E. coli T7 system. Bertelsen AB, Hackney CM, Bayer CN, Kjelgaard LD, Rennig M, Christensen B, Sorensen ES, Safavi-Hemami H, Wulff T, Ellgaard L, Norholm MHH. Microb Biotechnol. 2021 Nov;14(6):2566-2580. doi: 10.1111/1751-7915.13895. Epub 2021 Aug 18. 10.1111/1751-7915.13895 PubMed 34405535