pDRM98 mKate2 Blast
(Plasmid
#174720)
-
PurposeExpresses the NLS-tagged mKate2 gene, P2A and the blasticidin resistance gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRLSIN.cPPT.MND
- Backbone size w/o insert (bp) 6685
- Total vector size (bp) 7087
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemKate2
-
SpeciesSynthetic
-
Insert Size (bp)693
- Promoter MND
-
Tags
/ Fusion Proteins
- SV40 NLS with GGS linker (N terminal on backbone)
- P2A linker (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer MND-F (GTTCGCTTCTCGCTTCTGTT)
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBSD
-
Alt nameBlasticidin-S deaminase/BlastR
-
SpeciesAspergillus terreus
-
Insert Size (bp)393
-
GenBank ID
- Promoter MND (off mKate-P2A)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer WPRE-R (GCGTAAAAGGAGCAACATAG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRM98 mKate2 Blast was a gift from Wayne Tilley (Addgene plasmid # 174720 ; http://n2t.net/addgene:174720 ; RRID:Addgene_174720) -
For your References section:
Selective inhibition of CDK9 in triple negative breast cancer. Mustafa EH, Laven-Law G, Kikhtyak Z, Nguyen V, Ali S, Pace AA, Iggo R, Kebede A, Noll B, Wang S, Winter JM, Dwyer AR, Tilley WD, Hickey TE. Oncogene. 2023 Nov 24. doi: 10.1038/s41388-023-02892-3. 10.1038/s41388-023-02892-3 PubMed 38001268