-
PurposeExpresses WIPI2B fused to Halo in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHTN
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6143
- Total vector size (bp) 7410
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameWIPI2B
-
SpeciesH. sapiens (human)
-
Entrez GeneWIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
- Promoter CMV
-
Tag
/ Fusion Protein
- HaloTag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cctgatcggcagcgagatcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySharon Tooze, Francis Crick Institute, UK
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-WIPI2B WT was a gift from Erika Holzbaur & Andrea Stavoe (Addgene plasmid # 175025 ; http://n2t.net/addgene:175025 ; RRID:Addgene_175025) -
For your References section:
Expression of WIPI2B counteracts age-related decline in autophagosome biogenesis in neurons. Stavoe AK, Gopal PP, Gubas A, Tooze SA, Holzbaur EL. Elife. 2019 Jul 16;8. pii: 44219. doi: 10.7554/eLife.44219. 10.7554/eLife.44219 PubMed 31309927