-
PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZ
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV hSyn FLEX
- Backbone size w/o insert (bp) 4852
- Total vector size (bp) 6673
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructions<8 hours
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepAAV hSyn FLEX iGluSnFR3 v857.SGZ
-
Alt nameiGluSnFR3 v857.SGZ
-
Alt nameiGluSnFR3 556dot857.SGZ
-
Alt namev857.SGZ
-
SpeciesM. musculus (mouse), R. norvegicus (rat), Synthetic
-
Insert Size (bp)1821
- Promoter human Synapsin
-
Tags
/ Fusion Proteins
- IgK-chain (N terminal on insert)
- Myc epi tag (C terminal on insert)
- Stargazin and PDZ domain (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGAGTCGTGTCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV.hSyn.FLEX.iGluSnFR3.v857.SGZ.codonopt was a gift from Kaspar Podgorski (Addgene plasmid # 175182 ; http://n2t.net/addgene:175182 ; RRID:Addgene_175182) -
For your References section:
Glutamate indicators with improved activation kinetics and localization for imaging synaptic transmission. Aggarwal A, Liu R, Chen Y, Ralowicz AJ, Bergerson SJ, Tomaska F, Mohar B, Hanson TL, Hasseman JP, Reep D, Tsegaye G, Yao P, Ji X, Kloos M, Walpita D, Patel R, Mohr MA, Tillberg PW, Looger LL, Marvin JS, Hoppa MB, Konnerth A, Kleinfeld D, Schreiter ER, Podgorski K. Nat Methods. 2023 May 4. doi: 10.1038/s41592-023-01863-6. 10.1038/s41592-023-01863-6 PubMed 37142767