Skip to main content
Addgene

pCAG-loxpSTOPloxp-lyn-NeonGreen
(Plasmid #175257)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175257 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG-loxSTOPlox-EGFP
  • Backbone size w/o insert (bp) 5711
  • Vector type
    Mammalian Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lyn membrane targeting motif
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    756
  • Mutation
    None (wt)
  • Promoter pCAG
  • Tag / Fusion Protein
    • mNeonGreen (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site SwaI (not destroyed)
  • 5′ sequencing primer pCAG forward (GCAACGTGCTGGTTATTGTG)
  • 3′ sequencing primer NeonGFP reverse (5’-GGAGAGAGGCCATGTTATCC-3’)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Membrane targetting sequence is Lyn (MGCIKSKRKD)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-loxpSTOPloxp-lyn-NeonGreen was a gift from Frank Bradke & Sebastián Dupraz (Addgene plasmid # 175257 ; http://n2t.net/addgene:175257 ; RRID:Addgene_175257)
  • For your References section:

    In Situ Visualization of Axon Growth and Growth Cone Dynamics in Acute Ex Vivo Embryonic Brain Slice Cultures. Alfadil E, Bradke F, Dupraz S. J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068. 10.3791/63068 PubMed 34723948