pTub-alpha1-Lifeact-GFP
(Plasmid
#175437)
-
PurposeF-actin structures labelling
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTub-alpha1-EGFP
- Backbone size w/o insert (bp) 4501
- Total vector size (bp) 5291
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLifeact-EGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)790
- Promoter pTub-alpha1
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pCAG forward (GCAACGTGCTGGTTATTGTG)
- 3′ sequencing primer pCAG_AcGFP forward (5'-GTTCGGCTTCTGGCGTGTG-3' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTub-alpha1-Lifeact-GFP was a gift from Frank Bradke & Sebastián Dupraz (Addgene plasmid # 175437 ; http://n2t.net/addgene:175437 ; RRID:Addgene_175437) -
For your References section:
In Situ Visualization of Axon Growth and Growth Cone Dynamics in Acute Ex Vivo Embryonic Brain Slice Cultures. Alfadil E, Bradke F, Dupraz S. J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068. 10.3791/63068 PubMed 34723948