Skip to main content

pTub-alpha1-Lifeact-GFP
(Plasmid #175437)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175437 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTub-alpha1-EGFP
  • Backbone size w/o insert (bp) 4501
  • Total vector size (bp) 5291
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lifeact-EGFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    790
  • Promoter pTub-alpha1
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pCAG forward (GCAACGTGCTGGTTATTGTG)
  • 3′ sequencing primer pCAG_AcGFP forward (5'-GTTCGGCTTCTGGCGTGTG-3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTub-alpha1-Lifeact-GFP was a gift from Frank Bradke & Sebastián Dupraz (Addgene plasmid # 175437 ; http://n2t.net/addgene:175437 ; RRID:Addgene_175437)
  • For your References section:

    In Situ Visualization of Axon Growth and Growth Cone Dynamics in Acute Ex Vivo Embryonic Brain Slice Cultures. Alfadil E, Bradke F, Dupraz S. J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068. 10.3791/63068 PubMed 34723948