Skip to main content

pX335-NQL002-WAPL-sgRNA1
(Plasmid #175550)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175550 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX335
  • Backbone manufacturer
    Addgene 42335
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use together with pX335-NQL003-WAPL-sgRNA2
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9-nickase and sgRNA against mouse WAPL STOP Codon
  • gRNA/shRNA sequence
    TCACTCTAGAGATAGACTTC
  • Species
    M. musculus (mouse)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335-NQL002-WAPL-sgRNA1 was a gift from Elzo de Wit (Addgene plasmid # 175550 ; http://n2t.net/addgene:175550 ; RRID:Addgene_175550)
  • For your References section:

    WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation. Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E. Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. 10.1038/s41588-020-00744-4 PubMed 33318687