pBx1-VHH template1-3XMyc-Spacer
(Plasmid
#176208)
-
PurposePCR template for generating CeVICA VHH/nanobody library
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBx1
- Backbone size w/o insert (bp) 2561
- Total vector size (bp) 3256
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVHH template1-3XMyc-Spacer
-
SpeciesSynthetic
-
Insert Size (bp)695
- Promoter T7
-
Tag
/ Fusion Protein
- Myc tag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCACCTGACGTCGACGGATCGGGA
- 3′ sequencing primer TCCTTTCGGGCTTTGTTAGCAGCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBx1-VHH template1-3XMyc-Spacer was a gift from Aviv Regev (Addgene plasmid # 176208 ; http://n2t.net/addgene:176208 ; RRID:Addgene_176208) -
For your References section:
A cell-free nanobody engineering platform rapidly generates SARS-CoV-2 neutralizing nanobodies. Chen X, Gentili M, Hacohen N, Regev A. Nat Commun. 2021 Sep 17;12(1):5506. doi: 10.1038/s41467-021-25777-z. 10.1038/s41467-021-25777-z PubMed 34535642