Skip to main content

pDisplay-FRISZ
(Plasmid #176887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176887 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDisplay
  • Backbone size w/o insert (bp) 828
  • Total vector size (bp) 6091
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FRISZ
  • Species
    Synthetic
  • Insert Size (bp)
    828
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • pDisplay backbone elements for export and membrane anchor

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When selecting zinc biosensors for your particular application, please pay attention to the Kd. The Kd of the sensor has to match the concentration range of your particular experiments.

Please note: The plasmid contains a LD amino acid insertion before amino acid 158 and a Q158E mutation in the NeoR/KanR. The plasmid also contains a 7 bp deletion in the SV40 promoter. These differences are not known to affect plasmid function.

Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDisplay-FRISZ was a gift from Huiwang Ai (Addgene plasmid # 176887 ; http://n2t.net/addgene:176887 ; RRID:Addgene_176887)
  • For your References section:

    A genetically encoded far-red fluorescent indicator for imaging synaptically released Zn(2). Wu T, Kumar M, Zhang J, Zhao S, Drobizhev M, McCollum M, Anderson CT, Wang Y, Pokorny A, Tian X, Zhang Y, Tzounopoulos T, Ai HW. Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1. 10.1126/sciadv.add2058 PubMed 36857451