Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTorPE-FRISZ
(Plasmid #176888)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176888 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTorPE
  • Backbone size w/o insert (bp) 921
  • Total vector size (bp) 5126
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FRISZ
  • Species
    Synthetic
  • Insert Size (bp)
    1317
  • Promoter araBAD promoter
  • Tags / Fusion Proteins
    • Twin-Strep-tag (C terminal on insert)
    • Periplasmic expression TorA tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XholI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CATTGTTAACGCCGCGACG
  • 3′ sequencing primer CTTCTGCGTTCTGATTTAATCTGTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a R362W mutation in the insert at the start of the strep tag. This mutation is not known to affect plasmid function.

Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTorPE-FRISZ was a gift from Huiwang Ai (Addgene plasmid # 176888 ; http://n2t.net/addgene:176888 ; RRID:Addgene_176888)
  • For your References section:

    A genetically encoded far-red fluorescent indicator for imaging synaptically released Zn(2). Wu T, Kumar M, Zhang J, Zhao S, Drobizhev M, McCollum M, Anderson CT, Wang Y, Pokorny A, Tian X, Zhang Y, Tzounopoulos T, Ai HW. Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1. 10.1126/sciadv.add2058 PubMed 36857451