pTorPE-FRISZ
(Plasmid
#176888)
-
PurposeFar-red fluorescent zinc indicator FRISZ in pTorPE vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTorPE
- Backbone size w/o insert (bp) 921
- Total vector size (bp) 5126
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFRISZ
-
SpeciesSynthetic
-
Insert Size (bp)1317
- Promoter araBAD promoter
-
Tags
/ Fusion Proteins
- Twin-Strep-tag (C terminal on insert)
- Periplasmic expression TorA tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XholI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CATTGTTAACGCCGCGACG
- 3′ sequencing primer CTTCTGCGTTCTGATTTAATCTGTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a R362W mutation in the insert at the start of the strep tag. This mutation is not known to affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTorPE-FRISZ was a gift from Huiwang Ai (Addgene plasmid # 176888 ; http://n2t.net/addgene:176888 ; RRID:Addgene_176888) -
For your References section:
A genetically encoded far-red fluorescent indicator for imaging synaptically released Zn(2). Wu T, Kumar M, Zhang J, Zhao S, Drobizhev M, McCollum M, Anderson CT, Wang Y, Pokorny A, Tian X, Zhang Y, Tzounopoulos T, Ai HW. Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1. 10.1126/sciadv.add2058 PubMed 36857451