Skip to main content

pUAST-pHuji-GINKO2
(Plasmid #177117)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177117 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUAST
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pHuji-GINKO2
  • Species
    Synthetic
  • Promoter hsp70 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAACTACTGAAATCTGCCAAG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUAST-pHuji-GINKO2 was a gift from Robert Campbell (Addgene plasmid # 177117 ; http://n2t.net/addgene:177117 ; RRID:Addgene_177117)
  • For your References section:

    A sensitive and specific genetically-encoded potassium ion biosensor for in vivo applications across the tree of life. Wu SY, Wen Y, Serre NBC, Laursen CCH, Dietz AG, Taylor BR, Drobizhev M, Molina RS, Aggarwal A, Rancic V, Becker M, Ballanyi K, Podgorski K, Hirase H, Nedergaard M, Fendrych M, Lemieux MJ, Eberl DF, Kay AR, Campbell RE, Shen Y. PLoS Biol. 2022 Sep 6;20(9):e3001772. doi: 10.1371/journal.pbio.3001772. eCollection 2022 Sep. 10.1371/journal.pbio.3001772 PubMed 36067248