pENTR PKAKTRn-Clover
(Plasmid
#177199)
-
PurposeGateway entry vector encoding PKAKTRnew-Clover
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepENTR
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePKAKTRnew-mClover
-
SpeciesSynthetic
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR PKAKTRn-Clover was a gift from Markus Covert (Addgene plasmid # 177199 ; http://n2t.net/addgene:177199 ; RRID:Addgene_177199) -
For your References section:
A multiplexed epitope barcoding strategy that enables dynamic cellular phenotypic screens. Kudo T, Lane K, Covert MW. Cell Syst. 2022 May 18;13(5):376-387.e8. doi: 10.1016/j.cels.2022.02.006. Epub 2022 Mar 21. 10.1016/j.cels.2022.02.006 PubMed 35316656