-
PurposeHost Cell Reactivation (HCR) control GFP plasmid (pMax backbone)
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMax
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCAATAGCATCACAAATTTCACA
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information, see Piett, Pecen et al. 2021 Nat Protoc. (doi: 10.1038/s41596-021-00577-3).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMax_GFP was a gift from Zachary Nagel & Leona Samson (Addgene plasmid # 177825 ; http://n2t.net/addgene:177825 ; RRID:Addgene_177825) -
For your References section:
Multiplexed DNA repair assays for multiple lesions and multiple doses via transcription inhibition and transcriptional mutagenesis. Nagel ZD, Margulies CM, Chaim IA, McRee SK, Mazzucato P, Ahmad A, Abo RP, Butty VL, Forget AL, Samson LD. Proc Natl Acad Sci U S A. 2014 May 6;111(18):E1823-32. doi: 10.1073/pnas.1401182111. Epub 2014 Apr 22. 10.1073/pnas.1401182111 PubMed 24757057