Skip to main content

6xAP-1_RE::Renilla
(Plasmid #178317)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178317 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Alpha C Vector
  • Backbone manufacturer
    Venken Lab, #124525
  • Backbone size w/o insert (bp) 2326
  • Total vector size (bp) 3844
  • Vector type
    Mammalian Expression, Luciferase, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AP-1 Renilla Reporter
  • Alt name
    Transcription Blocker + 6 copies of the AP-1 DNA binding motif + miniP, Renilla Luciferase
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1518

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer aatgagctgatttaacaaaaatttaacgcg
  • 3′ sequencing primer ctttttacggttcctggccttttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    6xAP-1_RE::Renilla was a gift from Koen Venken (Addgene plasmid # 178317 ; http://n2t.net/addgene:178317 ; RRID:Addgene_178317)
  • For your References section:

    Synthetic Assembly DNA Cloning of Multiplex Hextuple Luciferase Reporter Plasmids. Sarrion-Perdigones A, Gonzalez Y, Venken KJT. Methods Mol Biol. 2022;2524:409-432. doi: 10.1007/978-1-0716-2453-1_32. 10.1007/978-1-0716-2453-1_32 PubMed 35821490