Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CAG-miRFP2
(Plasmid #178968)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178968 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CAG
  • Backbone size w/o insert (bp) 939
  • Total vector size (bp) 5665
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miRFP2
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
    939
  • Mutation
    NO
  • Promoter CAG
  • Tag / Fusion Protein
    • no (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ccttttatggcgaggcggcg
  • 3′ sequencing primer aaagcagcgtatccacatagcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-miRFP2 was a gift from Kiryl Piatkevich (Addgene plasmid # 178968 ; http://n2t.net/addgene:178968 ; RRID:Addgene_178968)
  • For your References section:

    Rapid directed molecular evolution of fluorescent proteins in mammalian cells. Babakhanova S, Jung EE, Namikawa K, Zhang H, Wang Y, Subach OM, Korzhenevskiy DA, Rakitina TV, Xiao X, Wang W, Shi J, Drobizhev M, Park D, Eisenhard L, Tang H, Koster RW, Subach FV, Boyden ES, Piatkevich KD. Protein Sci. 2022 Mar;31(3):728-751. doi: 10.1002/pro.4261. Epub 2021 Dec 30. 10.1002/pro.4261 PubMed 34913537