pHN922
(Plasmid
#178975)
-
PurposeExpression of GST-His8-GFP-nanobody
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-6P-1
-
Backbone manufacturerCytiva
- Total vector size (bp) 5320
-
Vector typeBacterial Expression, Affinity Reagent/ Antibody
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGST-His8-GFP-nanobody
-
SpeciesSynthetic
-
Insert Size (bp)355
- Promoter tac
-
Tag
/ Fusion Protein
- GST, His8 (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTTATACATGGACCCAATGTGC
- 3′ sequencing primer ATCCGCTTACAGACAAGCTGTGAC (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHN922 was a gift from Kazuhiro Abe (Addgene plasmid # 178975 ; http://n2t.net/addgene:178975 ; RRID:Addgene_178975)