GA_HBV_MS2_(AmpR)
(Plasmid
#179155)
-
PurposeEncodes the X, C and S genes of Hepatitis B Virus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMX
-
Backbone manufacturerThemoFisher Scientific
- Backbone size w/o insert (bp) 2353
- Total vector size (bp) 4148
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXCS Gene
-
SpeciesHepatitis B Virus
-
Insert Size (bp)1795
-
GenBank ID
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGGGTTTTCCCAGTCACGACGTT
- 3′ sequencing primer CAGGAAACAGCTATGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byReceived from GeneArt as a synthesised product.
Terms and Licenses
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.04.506540 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GA_HBV_MS2_(AmpR) was a gift from Paul Freemont (Addgene plasmid # 179155 ; http://n2t.net/addgene:179155 ; RRID:Addgene_179155) -
For your References section:
Simple Low-Cost Production of DNA MS2 Virus-Like Particles As Molecular Diagnostic Controls. Crone MA, Freemont PS. GEN Biotechnol. 2022 Dec 1;1(6):496-503. doi: 10.1089/genbio.2022.0033. Epub 2022 Dec 21. 10.1089/genbio.2022.0033 PubMed 36644571