pMC_MS2_DNA_VLP
(Plasmid
#179156)
-
PurposeExpression of maturation protein and his-tagged coat protein dimer from MS2 phage
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMX
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 2353
- Total vector size (bp) 4466
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMaturation Protein
-
Alt nameA-Protein
-
SpeciesMS2 Phage
-
Insert Size (bp)1182
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer AGGGTTTTCCCAGTCACGACGTT
- 3′ sequencing primer CAGGAAACAGCTATGACC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCoat Protein Dimer
-
SpeciesSynthetic
-
Insert Size (bp)801
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer AGGGTTTTCCCAGTCACGACGTT
- 3′ sequencing primer CAGGAAACAGCTATGACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.04.506540 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMC_MS2_DNA_VLP was a gift from Paul Freemont (Addgene plasmid # 179156 ; http://n2t.net/addgene:179156 ; RRID:Addgene_179156) -
For your References section:
Simple Low-Cost Production of DNA MS2 Virus-Like Particles As Molecular Diagnostic Controls. Crone MA, Freemont PS. GEN Biotechnol. 2022 Dec 1;1(6):496-503. doi: 10.1089/genbio.2022.0033. Epub 2022 Dec 21. 10.1089/genbio.2022.0033 PubMed 36644571