Skip to main content
Addgene

pMC_MS2_DNA_VLP
(Plasmid #179156)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179156 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pMX
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 2353
  • Total vector size (bp) 4466
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Maturation Protein
  • Alt name
    A-Protein
  • Species
    MS2 Phage
  • Insert Size (bp)
    1182
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer AGGGTTTTCCCAGTCACGACGTT
  • 3′ sequencing primer CAGGAAACAGCTATGACC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Coat Protein Dimer
  • Species
    Synthetic
  • Insert Size (bp)
    801
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer AGGGTTTTCCCAGTCACGACGTT
  • 3′ sequencing primer CAGGAAACAGCTATGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMC_MS2_DNA_VLP was a gift from Paul Freemont (Addgene plasmid # 179156 ; http://n2t.net/addgene:179156 ; RRID:Addgene_179156)
  • For your References section:

    Simple Low-Cost Production of DNA MS2 Virus-Like Particles As Molecular Diagnostic Controls. Crone MA, Freemont PS. GEN Biotechnol. 2022 Dec 1;1(6):496-503. doi: 10.1089/genbio.2022.0033. Epub 2022 Dec 21. 10.1089/genbio.2022.0033 PubMed 36644571