Skip to main content

GFP-LacI-p300
(Plasmid #179270)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179270 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    GFP-LacI-polylinker
  • Backbone size w/o insert (bp) 7304
  • Total vector size (bp) 14469
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB10β cells
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E1A binding protein p300
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7242
  • GenBank ID
    NM_001429.1 NG_009817.1
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP-LacI (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Acc65I (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTGAAGGGCAATCAGCTGTT
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-LacI-p300 was a gift from Lienhard Schmitz (Addgene plasmid # 179270 ; http://n2t.net/addgene:179270 ; RRID:Addgene_179270)
  • For your References section:

    Testing the Effect of Histone Acetyltransferases on Local Chromatin Compaction. Pfisterer M, Schmitz ML. Methods Mol Biol. 2023;2589:361-376. doi: 10.1007/978-1-0716-2788-4_24. 10.1007/978-1-0716-2788-4_24 PubMed 36255637