Skip to main content
Addgene

GFP-LacI-polylinker
(Plasmid #179271)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179271 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone manufacturer
    Takara
  • Backbone size (bp) 7304
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Selectable markers
    Neomycin (select with G418)
  • Tags / Fusion Proteins
    • GFP (N terminal on backbone)
    • LacI

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-LacI-polylinker was a gift from Lienhard Schmitz (Addgene plasmid # 179271 ; http://n2t.net/addgene:179271 ; RRID:Addgene_179271)
  • For your References section:

    Chromatin Targeting of HIPK2 Leads to Acetylation-Dependent Chromatin Decondensation. Haas J, Bloesel D, Bacher S, Kracht M, Schmitz ML. Front Cell Dev Biol. 2020 Sep 1;8:852. doi: 10.3389/fcell.2020.00852. eCollection 2020. 10.3389/fcell.2020.00852 PubMed 32984337