GFP-LacI-polylinker
(Plasmid
#179271)
-
Purpose(Empty Backbone) Cloning of GFP-LacI fusion proteins for LacI/LacO tethering
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA3.1
-
Backbone manufacturerTakara
- Backbone size (bp) 7304
-
Vector typeMammalian Expression
- Promoter CMV
-
Selectable markersNeomycin (select with G418)
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- LacI
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-LacI-polylinker was a gift from Lienhard Schmitz (Addgene plasmid # 179271 ; http://n2t.net/addgene:179271 ; RRID:Addgene_179271) -
For your References section:
Chromatin Targeting of HIPK2 Leads to Acetylation-Dependent Chromatin Decondensation. Haas J, Bloesel D, Bacher S, Kracht M, Schmitz ML. Front Cell Dev Biol. 2020 Sep 1;8:852. doi: 10.3389/fcell.2020.00852. eCollection 2020. 10.3389/fcell.2020.00852 PubMed 32984337