pCDHblast-flx-sORF-Katushka
(Plasmid
#179457)
-
PurposeLentiviral vector encoding a CRE inducible Katushka gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-blast
- Backbone size w/o insert (bp) 7050
- Total vector size (bp) 8787
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameloxP-shuffledORF-loxP-Katushka
-
SpeciesSynthetic
-
Insert Size (bp)1650
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDHblast-flx-sORF-Katushka was a gift from Ton Schumacher (Addgene plasmid # 179457 ; http://n2t.net/addgene:179457 ; RRID:Addgene_179457) -
For your References section:
Replicative history marks transcriptional and functional disparity in the CD8(+) T cell memory pool. Bresser K, Kok L, Swain AC, King LA, Jacobs L, Weber TS, Perie L, Duffy KR, de Boer RJ, Scheeren FA, Schumacher TN. Nat Immunol. 2022 May;23(5):791-801. doi: 10.1038/s41590-022-01171-9. Epub 2022 Apr 7. 10.1038/s41590-022-01171-9 PubMed 35393592