Skip to main content

pJET-49-DExogron-mNeonGreen-R11a
(Plasmid #179903)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179903 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 4957
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR ; Donor for homologous based knock in
  • Selectable markers
    mNeonGreen

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RAB11A, member RAS oncogene family
  • Alt name
    YL8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1983
  • Entrez Gene
    RAB11A (a.k.a. YL8)
  • Promoter TRE3GS
  • Tag / Fusion Protein
    • minilAA7-mNeonGreen (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCG
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Here donor for DExogron Rab11a knock in. DExogron = DExCon (Doxycycline-mediated endogenous gene Expression Control) combined with auxin-mediated targeted protein degradation. Lentiviral delivery of AtAFBP2 and TetOn 3G is also required for this to work.

https://figshare.com/projects/DExCon_DExogron_LUXon_on-demand_expression_control_of_endogenous_genes_reveals_differential_dynamics_of_Rab11_family_members/118281.

Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET-49-DExogron-mNeonGreen-R11a was a gift from Patrick Caswell (Addgene plasmid # 179903 ; http://n2t.net/addgene:179903 ; RRID:Addgene_179903)
  • For your References section:

    On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members. Gemperle J, Harrison TS, Flett C, Adamson AD, Caswell PT. Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651. 10.7554/eLife.76651 PubMed 35708998