Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAVS1-SA-neo-CAGGS-PE2-2A-GFP
(Plasmid #180014)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180014 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    unknown
  • Vector type
    CRISPR ; Human genome engineering

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PE2-2A-GFP
  • Species
    Synthetic
  • Insert Size (bp)
    7244
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer SP-CAGGS (TTCGGCTTCTGGCGTGTG)
  • 3′ sequencing primer ASP_AAVS1-HR-R (TCACCAATCCTGTCCCTAGT)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-SA-neo-CAGGS-PE2-2A-GFP was a gift from Dirk Hockemeyer (Addgene plasmid # 180014 ; http://n2t.net/addgene:180014 ; RRID:Addgene_180014)
  • For your References section:

    Highly efficient generation of isogenic pluripotent stem cell models using prime editing. Li H, Busquets O, Verma Y, Syed KM, Kutnowski N, Pangilinan GR, Gilbert LA, Bateup HS, Rio DC, Hockemeyer D, Soldner F. Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208. 10.7554/eLife.79208 PubMed 36069759