Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCCL/IFNB1-d2eGFP-3’UTR
(Plasmid #180232)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180232 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    d2eGFP
  • Alt name
    Destabilized eGFP
  • Insert Size (bp)
    846
  • Promoter 1 kb upstream of IFNB1 CDS

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGGATCTCGACGGTATCGG
  • 3′ sequencing primer ATAGCATGATACAAAGGCAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCCL/IFNB1-d2eGFP-3’UTR was a gift from Jacob Giehm Mikkelsen (Addgene plasmid # 180232 ; http://n2t.net/addgene:180232 ; RRID:Addgene_180232)
  • For your References section:

    Single-Cell Monitoring of Activated Innate Immune Signaling by a d2eGFP-Based Reporter Mimicking Time-Restricted Activation of IFNB1 Expression. Thomsen EA, Andersen S, Marqvorsen MHS, Skipper KA, Paludan SR, Mikkelsen JG. Front Cell Infect Microbiol. 2022 Jan 18;11:784762. doi: 10.3389/fcimb.2021.784762. eCollection 2021. 10.3389/fcimb.2021.784762 PubMed 35118008