-
Purpose(Empty Backbone) Lentiviral expression vector for CRISPRa-SAM sgRNA with 10x capture sequence, and PCP-P65-HSF1 cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXPR_502
- Backbone size (bp) 8707
-
Modifications to backbone10x capture sequence 1 inserted into SAM sgRNA scaffold
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter U6
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gagggcctatttcccatgatt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypXPR_502 was a gift from John Doench & David Root (Addgene plasmid # 96923)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZR158_Lenti-U6-gRNA-10xCS1-PP7_hPGK-PCP-P65-HSF1-Puro was a gift from Alexander Marson (Addgene plasmid # 180273 ; http://n2t.net/addgene:180273 ; RRID:Addgene_180273) -
For your References section:
CRISPR activation and interference screens decode stimulation responses in primary human T cells. Schmidt R, Steinhart Z, Layeghi M, Freimer JW, Bueno R, Nguyen VQ, Blaeschke F, Ye CJ, Marson A. Science. 2022 Feb 4;375(6580):eabj4008. doi: 10.1126/science.abj4008. Epub 2022 Feb 4. 10.1126/science.abj4008 PubMed 35113687