AAV.CBA.YFP.miR-E_shControl
(Plasmid
#180386)
-
PurposeProducing AAV that encodes negative control shRNA with miR-E backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180386 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV.CBA.YFP.miR-E
- Backbone size w/o insert (bp) 6337
-
Vector typeAAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshControl
-
gRNA/shRNA sequenceaaggcagaagtatgcaaagcat
-
SpeciesOther
-
Insert Size (bp)97
- Promoter CBA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTACCTGAGCTACCAGTCC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV.CBA.YFP.miR-E_shControl was a gift from Huda Zoghbi (Addgene plasmid # 180386 ; http://n2t.net/addgene:180386 ; RRID:Addgene_180386) -
For your References section:
Dual targeting of brain region-specific kinases potentiates neurological rescue in Spinocerebellar ataxia type 1. Lee WS, Lavery L, Rousseaux MWC, Rutledge EB, Jang Y, Wan YW, Wu SR, Kim W, Al-Ramahi I, Rath S, Adamski CJ, Bondar VV, Tewari A, Soleimani S, Mota S, Yalamanchili HK, Orr HT, Liu Z, Botas J, Zoghbi HY. EMBO J. 2021 Apr 1;40(7):e106106. doi: 10.15252/embj.2020106106. Epub 2021 Mar 11. 10.15252/embj.2020106106 PubMed 33709453