Skip to main content
Addgene

UPB-pancreas (UPB7)
(Plasmid #180787)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180787 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAVrg-CAG-tdTomato-WPRE-SV40 (Addgene, Plasmid #59462)
  • Backbone manufacturer
    Edward Boyden
  • Backbone size w/o insert (bp) 6150
  • Total vector size (bp) 6523
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hM4D(Gi) (partial )
  • Species
    Synthetic
  • Insert Size (bp)
    373
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer catcgataccgtcgacaagatggcaggcctcatgattg
  • 3′ sequencing primer ctgctcgaagcggccgctctgcttcattagtgggctc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UPB-pancreas (UPB7) was a gift from Rui Chang (Addgene plasmid # 180787 ; http://n2t.net/addgene:180787 ; RRID:Addgene_180787)
  • For your References section:

    A multidimensional coding architecture of the vagal interoceptive system. Zhao Q, Yu CD, Wang R, Xu QJ, Dai Pra R, Zhang L, Chang RB. Nature. 2022 Mar;603(7903):878-884. doi: 10.1038/s41586-022-04515-5. Epub 2022 Mar 16. 10.1038/s41586-022-04515-5 PubMed 35296859