Skip to main content
Addgene

pHR-PD-1ecto&tmd-BTLAicd-mGFP
(Plasmid #180794)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180794 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PD-1ecto&tmd-BTLAint
  • Alt name
    PD-1 extracellular domain and transmembrane domain fused to BTLA intracellular domain
  • Species
    H. sapiens (human)
  • Entrez Gene
    PDCD1 (a.k.a. AIMTBS, CD279, PD-1, PD1, SLEB2, hPD-1, hPD-l, hSLE1)
  • Entrez Gene
    BTLA (a.k.a. BTLA1, CD272)
  • Promoter SFFV
  • Tag / Fusion Protein
    • mEGFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ccaatcagcctgcttctcgcttc
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-PD-1ecto&tmd-BTLAicd-mGFP was a gift from Enfu Hui (Addgene plasmid # 180794 ; http://n2t.net/addgene:180794 ; RRID:Addgene_180794)
  • For your References section:

    PD-1 and BTLA regulate T cell signaling differentially and only partially through SHP1 and SHP2. Xu X, Hou B, Fulzele A, Masubuchi T, Zhao Y, Wu Z, Hu Y, Jiang Y, Ma Y, Wang H, Bennett EJ, Fu G, Hui E. J Cell Biol. 2020 Jun 1;219(6). pii: 151801. doi: 10.1083/jcb.201905085. 10.1083/jcb.201905085 PubMed 32437509