pAAV-CAG-DIO-CFL-SN-P2A-GCaMP6f
(Plasmid
#181742)
-
PurposeAAV vector for expressing CFL-SN and GCaMP6f
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCFL-SN-P2A-GCaMP6f
-
Alt namehCofilin-SuperNova-GCaMP6f
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2670
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SN and GCaMP6f were cloned from DNA deposited to Addgene.
https://www.addgene.org/53234/
https://www.addgene.org/100835/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-DIO-CFL-SN-P2A-GCaMP6f was a gift from Yasunori Hayashi (Addgene plasmid # 181742 ; http://n2t.net/addgene:181742 ; RRID:Addgene_181742) -
For your References section:
Stepwise synaptic plasticity events drive the early phase of memory consolidation. Goto A, Bota A, Miya K, Wang J, Tsukamoto S, Jiang X, Hirai D, Murayama M, Matsuda T, McHugh TJ, Nagai T, Hayashi Y. Science. 2021 Nov 12;374(6569):857-863. doi: 10.1126/science.abj9195. Epub 2021 Nov 11. 10.1126/science.abj9195 PubMed 34762472