Skip to main content

pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
(Plasmid #181745)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181745 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BPK764 (Addgene Plasmid #65767)
  • Vector type
    Bacterial Expression ; in vitro transcription; T7 promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human/zebrafish codon optimized SpCas9
  • Alt name
    BPK848
  • gRNA/shRNA sequence
    GGGCACGGGCAGCTTGCCGG
  • Species
    Synthetic
  • Promoter T7
  • Tag / Fusion Protein
    • NLS(SV40)-3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer oBK311-GCCATTCGATGGTGTCCGG
  • 3′ sequencing primer oBK390-GCAAATTCGACCCGGTCGTCG Chloramphenicol
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848) was a gift from Benjamin Kleinstiver (Addgene plasmid # 181745 ; http://n2t.net/addgene:181745 ; RRID:Addgene_181745)
  • For your References section:

    Precise DNA cleavage using CRISPR-SpRYgests. Christie KA, Guo JA, Silverstein RA, Doll RM, Mabuchi M, Stutzman HE, Lin J, Ma L, Walton RT, Pinello L, Robb GB, Kleinstiver BP. Nat Biotechnol. 2022 Oct 6. pii: 10.1038/s41587-022-01492-y. doi: 10.1038/s41587-022-01492-y. 10.1038/s41587-022-01492-y PubMed 36203014