Skip to main content

PP023 - CAG::QuasAr6a-TS-dmCitrine-TSx3-ER2-p2a- jRGECO1a-CAAX
(Plasmid #182063)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182063 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti_CAG
  • Backbone size w/o insert (bp) 9691
  • Total vector size (bp) 12967
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    QuasAr6a-TS-dmCitrine-TSx3-ER2-p2a- jRGECO1a-CAAX
  • Species
    Synthetic
  • Insert Size (bp)
    3276
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCGGGCCCGGGATCTCGAG
  • 3′ sequencing primer gcgtatccacatagcgtaaaaggagcaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PP023 - CAG::QuasAr6a-TS-dmCitrine-TSx3-ER2-p2a- jRGECO1a-CAAX was a gift from Adam Cohen (Addgene plasmid # 182063 ; http://n2t.net/addgene:182063 ; RRID:Addgene_182063)
  • For your References section:

    Dendritic branch structure compartmentalizes voltage-dependent calcium influx in cortical layer 2/3 pyramidal cells. Landau AT, Park P, Wong-Campos JD, Tian H, Cohen AE, Sabatini BL. eLife. 2022 Mar 23;11. pii: 76993. doi: 10.7554/eLife.76993. 10.7554/eLife.76993 PubMed 35319464