-
PurposeExpresses VSVGmut protein in mammalian cells for lentiviral pseudotyping
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182229 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMD2
- Backbone size w/o insert (bp) 4284
- Total vector size (bp) 5820
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThis plasmids may run as a dimer. Please test multiple colonies to select the monomeric form.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSVGmut
-
Alt nameG glycoprotein
-
SpeciesVesicular Stomatitis Virus
-
Insert Size (bp)1536
-
MutationK47Q, R354A
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtgtgctggcccatcactttggcaaagcacgtgagatct
- 3′ sequencing primer cagccaccactttctgataggcagcctgcactggtggggt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutations originally described in Nikolic et al 2018: https://www.nature.com/articles/s41467-018-03432-4.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMD2-VSVGmut was a gift from Michael Birnbaum (Addgene plasmid # 182229 ; http://n2t.net/addgene:182229 ; RRID:Addgene_182229) -
For your References section:
Antigen identification and high-throughput interaction mapping by reprogramming viral entry. Dobson CS, Reich AN, Gaglione S, Smith BE, Kim EJ, Dong J, Ronsard L, Okonkwo V, Lingwood D, Dougan M, Dougan SK, Birnbaum ME. Nat Methods. 2022 Apr;19(4):449-460. doi: 10.1038/s41592-022-01436-z. Epub 2022 Apr 8. 10.1038/s41592-022-01436-z PubMed 35396484