-
PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into GABAergic neuron via ASCL1 and DLX2 expression
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182307 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUCM
- Backbone size w/o insert (bp) 12978
- Total vector size (bp) 15250
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAscl1
-
Alt nameASH1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)695
-
Entrez GeneAscl1 (a.k.a. ASH1, Mash1, bHLHa46)
- Promoter pTRE3G-bidirectional
-
Tag
/ Fusion Protein
- None
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KflI (unknown if destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer caagttggggtgggcgat
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDlx2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)997
-
Entrez GeneDlx2 (a.k.a. DII A, Dlx-2, Tes-1)
- Promoter pTRE3G-bidirectional
-
Tag
/ Fusion Protein
- None
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer tcactgatagggagtaaagtctg
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namepuroR-T2A-mycNLS-mTagBFP2
-
Insert Size (bp)1473
- Promoter EF1a
-
Tag
/ Fusion Protein
- T2A-mycNLS-mTagBFP2
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site N/A (unknown if destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMichael Ward lab
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TO-ASCL1-DLX2 was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 182307 ; http://n2t.net/addgene:182307 ; RRID:Addgene_182307) -
For your References section:
One-step induction of human GABAergic neurons promotes presynaptic development & synapse maturation. van Voorst TW, van Boven MA, Marinus KI, Colon-Mercado JM, Schretzmeir J, Haag C, Toonen RF, Koopmans F, Ward ME, Smit AB, van Kesteren RE, Verhage M, Cornelisse LN. bioRxiv [Preprint]. 2025 Jul 7:2025.06.30.662293. doi: 10.1101/2025.06.30.662293. 10.1101/2025.06.30.662293 PubMed 40672309