Skip to main content

PB-TO-ASCL1-DLX2
(Plasmid #182307)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182307 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUCM
  • Backbone size w/o insert (bp) 12978
  • Total vector size (bp) 15250
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Ascl1
  • Alt name
    ASH1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    695
  • Entrez Gene
    Ascl1 (a.k.a. ASH1, Mash1, bHLHa46)
  • Promoter pTRE3G-bidirectional
  • Tag / Fusion Protein
    • None

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KflI (unknown if destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer caagttggggtgggcgat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Dlx2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    997
  • Entrez Gene
    Dlx2 (a.k.a. DII A, Dlx-2, Tes-1)
  • Promoter pTRE3G-bidirectional
  • Tag / Fusion Protein
    • None

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer tcactgatagggagtaaagtctg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    puroR-T2A-mycNLS-mTagBFP2
  • Insert Size (bp)
    1473
  • Promoter EF1a
  • Tag / Fusion Protein
    • T2A-mycNLS-mTagBFP2

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SwaI (not destroyed)
  • 3′ cloning site N/A (unknown if destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-TO-ASCL1-DLX2 was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 182307 ; http://n2t.net/addgene:182307 ; RRID:Addgene_182307)
  • For your References section:

    One-step induction of human GABAergic neurons promotes presynaptic development & synapse maturation. van Voorst TW, van Boven MA, Marinus KI, Colon-Mercado JM, Schretzmeir J, Haag C, Toonen RF, Koopmans F, Ward ME, Smit AB, van Kesteren RE, Verhage M, Cornelisse LN. bioRxiv [Preprint]. 2025 Jul 7:2025.06.30.662293. doi: 10.1101/2025.06.30.662293. 10.1101/2025.06.30.662293 PubMed 40672309