pAAV-flex-GFP-shRNA-GluN1
              
              
                (Plasmid
                
                #182502)
              
            
            
            
          - 
            PurposeExpresses shRNA against mouse NMDA receptor NR1 subunit. Flexed cassette driven by hdc (pan neuronal) gene promoter
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182502 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepUC
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 6765
- 
              Vector typeMammalian Expression, AAV, RNAi, Cre/Lox
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namepan neuronal promoter (hdc basal promoter) driving flexed-GFP-mir30-shRNA NR1 cassette
- 
                    SpeciesSynthetic
- Promoter fragment of histidine decarboxylase gene promoter that gives pan-neuronal expression
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CATCCACTAAAGGGACTTCCAG
- 3′ sequencing primer GTCCAGCTCGACCAGGATG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pAAV-flex-GFP-shRNA-GluN1 was a gift from William Wisden (Addgene plasmid # 182502 ; http://n2t.net/addgene:182502 ; RRID:Addgene_182502)
- 
                For your References section: NMDA Receptors in the Lateral Preoptic Hypothalamus Are Essential for Sustaining NREM and REM Sleep. Miracca G, Anuncibay-Soto B, Tossell K, Yustos R, Vyssotski AL, Franks NP, Wisden W. J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022. 10.1523/JNEUROSCI.0350-21.2022 PubMed 35649726
 
    
 
                         
             
            