Skip to main content

pAAV-TRE-DIO-hM4Di-mCherry
(Plasmid #182532)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182532 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 6828
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAV transgene - hSyn promoter-tet-flex-hM4Di-cherry
  • Species
    Synthetic
  • Insert Size (bp)
    4076
  • Promoter tetO promoter
  • Tag / Fusion Protein
    • hM4Di-mCherry

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer catcgtggaacagtacgaac
  • 3′ sequencing primer caacttcacacctgtcaatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The hM4di-Cherry part of the insert was a gift from Bryan L. Roth, Addgene plasmid #50475

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-TRE-DIO-hM4Di-mCherry was a gift from William Wisden (Addgene plasmid # 182532 ; http://n2t.net/addgene:182532 ; RRID:Addgene_182532)
  • For your References section:

    A specific circuit in the midbrain detects stress and induces restorative sleep. Yu X, Zhao G, Wang D, Wang S, Li R, Li A, Wang H, Nollet M, Chun YY, Zhao T, Yustos R, Li H, Zhao J, Li J, Cai M, Vyssotski AL, Li Y, Dong H, Franks NP, Wisden W. Science. 2022 Jul;377(6601):63-72. doi: 10.1126/science.abn0853. Epub 2022 Jun 30. 10.1126/science.abn0853 PubMed 35771921