pAAV-TRE-DIO-hM4Di-mCherry
(Plasmid
#182532)
-
PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The hM4Di receptor expression requires both neural activity and Cre recombinase.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182532 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 6828
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV transgene - hSyn promoter-tet-flex-hM4Di-cherry
-
SpeciesSynthetic
-
Insert Size (bp)4076
- Promoter tetO promoter
-
Tag
/ Fusion Protein
- hM4Di-mCherry
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer catcgtggaacagtacgaac
- 3′ sequencing primer caacttcacacctgtcaatg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe hM4di-Cherry part of the insert was a gift from Bryan L. Roth, Addgene plasmid #50475
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TRE-DIO-hM4Di-mCherry was a gift from William Wisden (Addgene plasmid # 182532 ; http://n2t.net/addgene:182532 ; RRID:Addgene_182532) -
For your References section:
A specific circuit in the midbrain detects stress and induces restorative sleep. Yu X, Zhao G, Wang D, Wang S, Li R, Li A, Wang H, Nollet M, Chun YY, Zhao T, Yustos R, Li H, Zhao J, Li J, Cai M, Vyssotski AL, Li Y, Dong H, Franks NP, Wisden W. Science. 2022 Jul;377(6601):63-72. doi: 10.1126/science.abn0853. Epub 2022 Jun 30. 10.1126/science.abn0853 PubMed 35771921