pSpCas9-Puro HLAG-2B-sgRNA
(Plasmid
#182552)
-
PurposeCas9 from S.pyogenes with 2A-Puro, and the 2B-sgRNA to targeting exon 2 of human HLA-G gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX459
-
Backbone manufacturerDr. Feng Zhang's Lab
- Total vector size (bp) 9176
-
Modifications to backbone2B-sgRNA targeting exon 2 HLA-G gene
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehSpCas9-2A-Puro-HLAG-2B-sgRNA
-
gRNA/shRNA sequenceGGACTTTAGAACCAGGACCG
-
SpeciesSynthetic
- Promoter Cbh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer hU6-F primer (5'-GAGGGCCTATTTCCCATGATT-3')
- 3′ sequencing primer 2B-sgRNA Rv (5'-CGGTCCTGGTTCTAAAGTCC-3')
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a version of Addgene Plasmid #62988 where the guide sequence HLAG/2B-sgRNA was cloned into this plasmid using BbsI sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9-Puro HLAG-2B-sgRNA was a gift from Santiago Miriuka (Addgene plasmid # 182552 ; http://n2t.net/addgene:182552 ; RRID:Addgene_182552) -
For your References section:
HLA-G gene editing in tumor cell lines as a novel alternative in cancer immunotherapy. Palma MB, Tronik-Le Roux D, Amin G, Castaneda S, Mobbs AM, Scarafia MA, La Greca A, Daouya M, Poras I, Inda AM, Moro LN, Carosella ED, Garcia MN, Miriuka SG. Sci Rep. 2021 Nov 12;11(1):22158. doi: 10.1038/s41598-021-01572-0. 10.1038/s41598-021-01572-0 PubMed 34773056