Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

m168
(Plasmid #34886)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34886 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV-VSV-G
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sindbis virus envelope protein
  • Species
    Sindbus Virus
  • Insert Size (bp)
    3400
  • GenBank ID
    AAA96976.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstEII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pCMV-VSV-G-Fwd: AACCGGGCCCCTCTGCTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

m168 is a mutated version of the Sinbis virus envelope protein, which includes the following mutations:

E3 domain--delta 61-64
E2 domain-- SLKQ68-71AAAA and KE159-160AA
ZZ domain of protein A inserted into E2 domain

This plasmid was created using Addgene Plasmid pCMV-VSV-G (#8454), where the VSV-G was removed and replaced with the Sindbis virus envelope protein (above).

See attached map for details on construction and recommended restriction digest analysis.

Please note that the Addgene sequencing results also found an R172G point mutation in the E2 domain--this is not expected to alter the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    m168 was a gift from Irvin Chen (Addgene plasmid # 34886 ; http://n2t.net/addgene:34886 ; RRID:Addgene_34886)
  • For your References section:

    Lentiviral vector retargeting to P-glycoprotein on metastatic melanoma through intravenous injection. Morizono K, Xie Y, Ringpis GE, Johnson M, Nassanian H, Lee B, Wu L, Chen IS. Nat Med. 2005 Mar;11(3):346-52. Epub 2005 Feb 13. 10.1038/nm1192 PubMed 15711560