pPB-Ins-TRE3Gp-dCas9-Suntag-VP64-EF1Ap-Puro
(Plasmid #183409)

• Purpose: piggyBAC-based doxycycline-inducible dCas9-5xSuntag-VP64 CRISPR activation plasmid for enhancer and promoter activation in mammalian cells
• Depositing Lab: Azim Surani
• Depositing Organization: University of Cambridge
  Located in United Kingdom of Great Britain and Northern Ireland
• Publication: Tang et al Nat Cell Biol. 2022 Apr;24(4):448-460. doi: 10.1038/s41556-022-00878-z. Epub 2022 Apr 11.

Backbone

• Vector backbone: PB510B-1
• Backbone manufacturer: System Biosciences
• Backbone size w/o insert (bp): 6067
• Total vector size (bp): 13630
• Modifications to backbone: The CMV promoter (cut by SpeI and NotI) was replaced by a TRE3G promoter fragment using In-fusion cloning. Subsequently, a synthetic VP64-GB1-NLS-pA fragment was inserted downstream of the TRE3G promoter (NotI). Finally, a dCas9-5xGCN4-P2A-scFv-sfGFP fragment was inserted upstream of the VP64 and downstream of the TRE3G promoter (NotI) to reconstitute the dCas9-Suntag-VP64 transgene.
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology ; piggyBAC
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dCas9-5xGCN5-P2A-scFV-sfGFP-VP64-GB1
• Species: Synthetic
• Insert Size (bp): 6984
• Promoter: TRE3G

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTTTAGGCGTGTACGGTGGG
• 3′ sequencing primer: GCACCCGTTCAATTGCCGAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Tetracycline controllable expression system by TET Systems

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 183409-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 183409-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.