Skip to main content

pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
(Plasmid #183411)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183411 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB510B-1
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 4422
  • Total vector size (bp) 7322
  • Modifications to backbone
    EF1Apromoter and TetOn3G-IRES-Neo fragments were inserted to the pPB-Ins backbone (cut by SpeI and ApaI) by In-fusion cloning. Subsequently, a U6promoter-sgRNAentry(Esp3I)-scaffold fragment was inserted.
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology ; piggyBAC
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tet-on 3G
  • Species
    Synthetic
  • Insert Size (bp)
    747
  • Promoter EF1A

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAAGTGCAGTAGTCGCCGTG
  • 3′ sequencing primer cctaggaatgctcgtcaaga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Tetracycline controllable expression system by TET Systems
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo was a gift from Azim Surani (Addgene plasmid # 183411 ; http://n2t.net/addgene:183411 ; RRID:Addgene_183411)
  • For your References section:

    Sequential enhancer state remodelling defines human germline competence and specification. Tang WWC, Castillo-Venzor A, Gruhn WH, Kobayashi T, Penfold CA, Morgan MD, Sun D, Irie N, Surani MA. Nat Cell Biol. 2022 Apr;24(4):448-460. doi: 10.1038/s41556-022-00878-z. Epub 2022 Apr 11. 10.1038/s41556-022-00878-z PubMed 35411086