pAAV-nEF Coff/Fon DREADD Gq-mCherry
(Plasmid
#183534)
-
PurposeINTRSECT Chemogenetics - expresses DREADD Gq-mCherry in cells expressing Flp but not Cre
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-nEF
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4605
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDREADD Gq-mCherry
-
SpeciesSynthetic
-
Insert Size (bp)3212
-
MutationNone
- Promoter nEF
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTTTAAAGCTCAGGTCGAGA
- 3′ sequencing primer GAATACCAGTCAATCTTTCAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-nEF Coff/Fon DREADD Gq-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 183534 ; http://n2t.net/addgene:183534 ; RRID:Addgene_183534)