Skip to main content

pPyPGK-Myc-LaG17-SynNotch-tTA-IRES-Ble
(Plasmid #183607)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183607 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPyPGK-IRES-Ble
  • Backbone size w/o insert (bp) 5272
  • Total vector size (bp) 7510
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LaG17 GFP nanobody SynNotch tTA
  • Species
    Synthetic
  • Insert Size (bp)
    2238
  • Promoter Mouse Pgk1
  • Tags / Fusion Proteins
    • human CD8a signal sequence (N terminal on insert)
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site Bsu36I (not destroyed)
  • 5′ sequencing primer CATTCTGCACGCTTCAAAAG
  • 3′ sequencing primer GCATTCCTTTGGCGAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Myc-LaG17-SynNotch-tTA cassette was a kind gift of Dr Wendell Lim and Dr Leonardo Morsut (Addgene plasmid 79128).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPyPGK-Myc-LaG17-SynNotch-tTA-IRES-Ble was a gift from Sally Lowell (Addgene plasmid # 183607 ; http://n2t.net/addgene:183607 ; RRID:Addgene_183607)
  • For your References section:

    SyNPL: Synthetic notch pluripotent cell lines to monitor and manipulate cell interactions in vitro and in vivo. Malaguti M, Migueles RP, Annoh J, Sadurska D, Blin G, Lowell S. Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226. 10.1242/dev.200226 PubMed 35616331