-
PurposeLentiviral vector expressing luciferase and mCherry.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep.FUW
-
Backbone manufacturerI. Verma, Salk
- Backbone size w/o insert (bp) 9221
- Total vector size (bp) 12296
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuc-E2A-mCherry-T2A-PuroR
-
Alt nameLuciferase
-
Alt namemCherry
-
Alt namePuroR (PAC)
-
SpeciesSynthetic
-
Insert Size (bp)2954
-
GenBank ID
- Promoter Human Ubiquitin C (UbC) promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGAAGCTCCGGTTTTGAACT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-Luc-mCherry-puro was a gift from Andrew Kung (Addgene plasmid # 183685 ; http://n2t.net/addgene:183685 ; RRID:Addgene_183685) -
For your References section:
In vivo pharmacodynamic imaging of proteasome inhibition. Kimbrel EA, Davis TN, Bradner JE, Kung AL. Mol Imaging. 2009 May-Jun;8(3):140-7. PubMed 19723471