Skip to main content

crTet in pSLQ8453
(Plasmid #183965)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183965 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    crTet
  • Alt name
    CRISPR RNA (crRNA) targeting TRE3G promoter
  • Species
    Synthetic
  • Promoter U6
  • Tag / Fusion Protein
    • EF1a-Puro-T2A-BFP (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgggtttattacagggacagcagag
  • 3′ sequencing primer gagccagtacacgacatcactttc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For backbone, please refer to Addgene plasmid # 140086 (Backbone for cloning U6 driven LbCpf1 (Cas12a) crRNA, EF1a driven BFP + puromycin resistance)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    crTet in pSLQ8453 was a gift from Stanley Qi (Addgene plasmid # 183965 ; http://n2t.net/addgene:183965 ; RRID:Addgene_183965)
  • For your References section:

    Multiplexed genome regulation in vivo with hyper-efficient Cas12a. Guo LY, Bian J, Davis AE, Liu P, Kempton HR, Zhang X, Chemparathy A, Gu B, Lin X, Rane DA, Xu X, Jamiolkowski RM, Hu Y, Wang S, Qi LS. Nat Cell Biol. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. 10.1038/s41556-022-00870-7 PubMed 35414015