SpyTag-sfGFP
(Plasmid
#184226)
-
PurposeExpresses SpyTag-superfolder GFP in the bacterial cytoplasm. SpyTag enables covalent reaction with SpyCatcher.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJ404
- Backbone size w/o insert (bp) 3987
- Total vector size (bp) 4821
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyTag-sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)834
- Promoter T5
-
Tags
/ Fusion Proteins
- SpyTag (N terminal on insert)
- TEV protease cleavage site (N terminal on insert)
- His6 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGCTCACAATTCCACAACGGTTTCCC
- 3′ sequencing primer CGAAAGGCTCAGTCGAAAGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SpyTag-sfGFP was a gift from Mark Howarth (Addgene plasmid # 184226 ; http://n2t.net/addgene:184226 ; RRID:Addgene_184226) -
For your References section:
SpySwitch enables pH- or heat-responsive capture and release for plug-and-display nanoassembly. Vester SK, Rahikainen R, Khairil Anuar INA, Hills RA, Tan TK, Howarth M. Nat Commun. 2022 Jun 28;13(1):3714. doi: 10.1038/s41467-022-31193-8. 10.1038/s41467-022-31193-8 PubMed 35764623