Skip to main content
Addgene

AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1
(Plasmid #184397)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184397 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript
  • Backbone size w/o insert (bp) 9318
  • Total vector size (bp) 12349
  • Vector type
    Mammalian Expression, CRISPR ; Donor plasmid for HDR
  • Selectable markers
    Neomycin (select with G418), Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase beta-globin-PTC39
  • Alt name
    Firefly luciferase NMD(+) reporter
  • Species
    H. sapiens (human), M. musculus (mouse); Photinus pyralis
  • Insert Size (bp)
    3031
  • Mutation
    PTC in beta-globin at amino acid position 39
  • Promoter Tet-On 3G
  • Tag / Fusion Protein
    • 3X FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (destroyed during cloning)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer AGTGCAGGTGCCAGAACATT
  • 3′ sequencing primer CAGCTCCTGGGCAATATGAT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The 3X-FLAG firefly luciferase beta-globin-PTC39 insert sequence is from a plasmid from James Inglese's lab (Addgene catalog # 112084, published in PMID: 29528287).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The backbone is from a plasmid from Masato Kanemaki’s lab (Addgene catalog # 72835, published in PMID: 27052166). The 3X-FLAG firefly luciferase beta-globin-PTC39 insert sequence replaces the OsTIR1 sequence in that plasmid. Additional cloning details are available in Udy et al., 2021 (PMID: 34880103).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1 was a gift from Robert Bradley (Addgene plasmid # 184397 ; http://n2t.net/addgene:184397 ; RRID:Addgene_184397)
  • For your References section:

    Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation. Udy DB, Bradley RK. Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. 10.26508/lsa.202101217 PubMed 34880103